mcsB [2018-05-18 15:50:54]

protein arginine kinase, tags proteins for degradation by ClpCP, adaptor protein, modulator of CtsR-dependent repression

Locus: BSU00850

Isoelectric point: 5.07

Molecular weight: 40.97 kDa

Protein length: 363 aa

Gene length: 1089 bp

Function: control of CtsR activity

Product: protein arginine kinase

Essential: no

Synonyms: yacI

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Heat shock proteins

Gene

Coordinates: 102,484 → 103,575

The protein

Catalyzed reaction/ biological activity

• phosphorylates and thereby targets non-functional CtsR for degradation by ClpP/ClpC PubMed

Protein family

• ATP:guanido phosphotransferase family (according to Swiss-Prot)

Modification

• autophosphorylation on specific arginine residues PubMed, dephosphorylation by YwlE PubMed
• autophosphorylation stimulates McsB activity as adaptor protein for ClpC PubMed

Expression and Regulation

Operons

• Genes: ctsR-mcsA-mcsB-clpC-radA-disA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon
  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • expressed during germination and spore outgrowth PubMed
  • induction during diamide stress (Spx) PubMed

Biological materials

Mutant

• MGNA-B930 (yacI::erm), available at the NBRP B. subtilis, Japan
• mcsB::aphA3 availbale from the Gerth lab
• mcsBC167S::spec available from the Gerth lab
• GP1457 (mcsB::aphA3), available in Jörg Stülke's lab
• BP69 (spc), available in Fabian Commichau's lab
• BKE00850 (ΔmcsB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
• BKK00850 (ΔmcsB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

Expression vector

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
• expression of native mcsB in B. subtilis: pBP186 (in pBQ200), available in Fabian Commichau's lab

Antibody

• available in Gerth lab

Labs working on this gene/protein

• Ulf Gerth, Greifswald, Germany
• Fabian Commichau Göttingen, Germany

References

Reviews

Loading

Original Publications

Loading